Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 1501237
End position: 1501263
Length: 27

DNA sequence
>NC_011658, from 1501237 to 1501263 (27 bp); Bacillus cereus AH187 AGCACCAGTAGCACCAGTAGCGCCAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1500524-1502455	Sequence	BCAH187_A1618 - hypothetical protein (Protein is coded in complementary strand; from 1502455 to 1500524)