Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 3147814
End position: 3147840
Length: 27

DNA sequence
>NC_011658, from 3147814 to 3147840 (27 bp); Bacillus cereus AH187 GTCGCTCCGGTTGCTCCGGTTGCTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3147265-3149868	Sequence	BCAH187_A3386 - hypothetical protein (Protein is coded in complementary strand; from 3149868 to 3147265)