Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 4315189
End position: 4315215
Length: 27

DNA sequence
>NC_011658, from 4315189 to 4315215 (27 bp); Bacillus cereus AH187 CCCGTTGCTCCCGTTACTCCCGTTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4314721-4316001	Sequence	BCAH187_A4655 - collagen triple helix repeat domain-containing protein (Protein is coded in complementary strand; from 4316001 to 4314721)