Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 4503032
End position: 4503058
Length: 27

DNA sequence
>NC_011658, from 4503032 to 4503058 (27 bp); Bacillus cereus AH187 CTCCGGTTGCTCCCGTTGCTCCGGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4502218-4505730	Sequence	BCAH187_A4862 - collagen triple helix repeat domain-containing protein (Protein is coded in complementary strand; from 4505730 to 4502218)