Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 4513999
End position: 4514025
Length: 27

DNA sequence
>NC_011658, from 4513999 to 4514025 (27 bp); Bacillus cereus AH187 GTGATGACCATGATGACCGTGCTGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4513517-4514467	Sequence	BCAH187_A4874 - VrrB (Protein is coded in complementary strand; from 4514467 to 4513517)