Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 3761076
End position: 3761105
Length: 30

DNA sequence
>NC_011658, from 3761076 to 3761105 (30 bp); Bacillus cereus AH187 TTTTTCTTTTCTTTTTTTCTGTTTTTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3760993-3761163	Sequence	BCAH187_A4011 - hypothetical protein (Protein is coded in complementary strand; from 3761163 to 3760993)