Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 4297554
End position: 4297583
Length: 30

DNA sequence
>NC_011658, from 4297554 to 4297583 (30 bp); Bacillus cereus AH187 TTATCTTTATCCTTATTTTTATCATTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4296489-4297712	Sequence	BCAH187_A4637 - sodium export permease protein (Protein is coded in complementary strand; from 4297712 to 4296489)