Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 4941101
End position: 4941130
Length: 30

DNA sequence
>NC_011658, from 4941101 to 4941130 (30 bp); Bacillus cereus AH187 GCTTGTGCTTGTGCTTGTGCTTGTGCTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4940582-4942039	Sequence	BCAH187_A5359 - cell wall endopeptidase and peptidase (Protein is coded in complementary strand; from 4942039 to 4940582)