Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 3109393
End position: 3109428
Length: 36

DNA sequence
>NC_011658, from 3109393 to 3109428 (36 bp); Bacillus cereus AH187 GGTTGTTGCTCTTGTTGTTTCTCTTGTTGTTTCTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3108931-3109773	Sequence	BCAH187_A3339 - putative lipoprotein (Protein is coded in complementary strand; from 3109773 to 3108931)