Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 3785075
End position: 3785110
Length: 36

DNA sequence
>NC_011658, from 3785075 to 3785110 (36 bp); Bacillus cereus AH187 TCCTTTTCTTTTCCATTTTCTTTTTTCTTTTCTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3784862-3785311	Sequence	BCAH187_A4051 - hypothetical protein (Protein is coded in complementary strand; from 3785311 to 3784862)