Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 3971559
End position: 3971594
Length: 36

DNA sequence
>NC_011658, from 3971559 to 3971594 (36 bp); Bacillus cereus AH187 TGCTCTGCAACTTGCATTGCAACTTGCTCTCCAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3970854-3971648	Sequence	BCAH187_A4268 - short chain dehydrogenase/reductase family oxidoreductase (Protein is coded in complementary strand; from 3971648 to 3970854)