Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 4096668
End position: 4096703
Length: 36

DNA sequence
>NC_011658, from 4096668 to 4096703 (36 bp); Bacillus cereus AH187 CAGCAACAATACCAACACCAATACCCGCAACAATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4096577-4096723	Sequence	BCAH187_A4420 - hypothetical protein (Protein is coded in complementary strand; from 4096723 to 4096577)