Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 4568761
End position: 4568796
Length: 36

DNA sequence
>NC_011658, from 4568761 to 4568796 (36 bp); Bacillus cereus AH187 TCTGGTTTCACTTCCGGTTTTACTTCTGGTTTCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4568623-4569441	Sequence	BCAH187_A4937 - putative S-layer protein (Protein is coded in complementary strand; from 4569441 to 4568623)