Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 696202
End position: 696237
Length: 36

DNA sequence
>NC_011658, from 696202 to 696237 (36 bp); Bacillus cereus AH187 TCTTTTTTTGTATCTTCTTTTGTATCTTCTTTCGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 695359-696324	Sequence	BCAH187_A0743 - iron compound ABC transporter iron compound-binding protein (Protein is coded in complementary strand; from 696324 to 695359)