Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 853176
End position: 853211
Length: 36

DNA sequence
>NC_011658, from 853176 to 853211 (36 bp); Bacillus cereus AH187 AGCGCCTCCAATTGCGCCGCCAATAGCGGCTGCAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 853003-854379	Sequence	BCAH187_A0917 scrA PTS system sucrose-specific transporter subunit IIBC (Protein is coded in complementary strand; from 854379 to 853003)