Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 1359191
End position: 1359235
Length: 45

DNA sequence
>NC_011658, from 1359191 to 1359235 (45 bp); Bacillus cereus AH187 TTCAGCAGGCTTTTGCTCGGCAGGTTTTTGCTCAGCCGGCTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1358709-1359536	Sequence	BCAH187_A1448 - hypothetical protein (Protein is coded in complementary strand; from 1359536 to 1358709)