Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 4016749
End position: 4016793
Length: 45

DNA sequence
>NC_011658, from 4016749 to 4016793 (45 bp); Bacillus cereus AH187 TTGTTTCTTTATTTGATGTTTCTTTATTTGATGTTTCCTTGTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4016319-4016990	Sequence	BCAH187_A4316 - stage III sporulation protein AH (Protein is coded in complementary strand; from 4016990 to 4016319)