Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 4259349
End position: 4259393
Length: 45

DNA sequence
>NC_011658, from 4259349 to 4259393 (45 bp); Bacillus cereus AH187 TCTTCTATTTCCTCTTCTTCTACTTCCTGCTCTTTTCTTTCTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4258995-4259978	Sequence	BCAH187_A4596 - putative stage VI sporulation protein D (Protein is coded in complementary strand; from 4259978 to 4258995)