Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 484316
End position: 484360
Length: 45

DNA sequence
>NC_011658, from 484316 to 484360 (45 bp); Bacillus cereus AH187 CTAGAGCCATTGCCACCCGAGCCGTTGCCACCAGAACCACTGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 483608-484786	Sequence	BCAH187_A0511 - lpxtg-motif cell wall anchor domain-containing protein (Protein is coded in complementary strand; from 484786 to 483608)