Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 2400372
End position: 2400419
Length: 48

DNA sequence
>NC_011658, from 2400372 to 2400419 (48 bp); Bacillus cereus AH187 GGTTCAAGAAGTGATTCAAGACGTGGTTCGAGAAATGGCTCAAGAAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2399158-2400522	Sequence	BCAH187_A2571 - DEAD/DEAH box family ATP-dependent RNA helicase