Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 1617747
End position: 1617800
Length: 54

DNA sequence
>NC_011658, from 1617747 to 1617800 (54 bp); Bacillus cereus AH187 GTTCCCAGTAGATCCAGTGTTCCCAGTAGGTCCAGAGTTTCCGGTAGGTCCAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1617537-1619213	Sequence	BCAH187_A1758 - hypothetical protein (Protein is coded in complementary strand; from 1619213 to 1617537)