Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 4331788
End position: 4331841
Length: 54

DNA sequence
>NC_011658, from 4331788 to 4331841 (54 bp); Bacillus cereus AH187 CCTCCGTCTGGTTGTTTACCTCCGTCTGGTTGTTTACCTCCGTCTGGTTGTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4330045-4332864	Sequence	BCAH187_A4674 - cell surface protein (Protein is coded in complementary strand; from 4332864 to 4330045)