Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 4471037
End position: 4471090
Length: 54

DNA sequence
>NC_011658, from 4471037 to 4471090 (54 bp); Bacillus cereus AH187 GGTGTTTCTTCTGCAACTGGTTGTTCTTCTACAACTGGTTGTTCTTCTACAACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4468892-4472704	Sequence	BCAH187_A4823 - ftsk/spoiiie family protein (Protein is coded in complementary strand; from 4472704 to 4468892)