Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 4547274
End position: 4547327
Length: 54

DNA sequence
>NC_011658, from 4547274 to 4547327 (54 bp); Bacillus cereus AH187 GGAAGCACTGGACCCACTGGCATCACTGGGCCCACTGGCATCACTGGACCCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4546348-4547922	Sequence	BCAH187_A4912 - collagen triple helix repeat domain-containing protein