Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 893862
End position: 893915
Length: 54

DNA sequence
>NC_011658, from 893862 to 893915 (54 bp); Bacillus cereus AH187 GAGCTTTAGCTGCTTCTTGAGCCTTAGCTTCTGCTTGAGCTTCAGCTACTGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 893477-894757	Sequence	BCAH187_A0959 - enterotoxin (Protein is coded in complementary strand; from 894757 to 893477)