Sequence retrieval

Genome: Escherichia coli IAI39
Start position: 3568451
End position: 3568474
Length: 24

DNA sequence
>NC_011750, from 3568451 to 3568474 (24 bp); Escherichia coli IAI39 GCAGCAGCATCAGCAGCGCCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3567847-3569040	Sequence	ECIAI39_3422 shiF putative membrane transport protein, major facilitator superfamily (Protein is coded in complementary strand; from 3569040 to 3567847)