Sequence retrieval

Genome: Escherichia coli IAI39
Start position: 3816589
End position: 3816615
Length: 27

DNA sequence
>NC_011750, from 3816589 to 3816615 (27 bp); Escherichia coli IAI39 CGCACGGCCAGCACGGCCCGCACGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3815735-3817624	Sequence	ECIAI39_3659 deaD ATP-dependent RNA helicase DeaD (Protein is coded in complementary strand; from 3817624 to 3815735)