Sequence retrieval

Genome: Escherichia coli IAI39
Start position: 1193442
End position: 1193469
Length: 28

DNA sequence
>NC_011750, from 1193442 to 1193469 (28 bp); Escherichia coli IAI39 ACCAGCAACCAGCGACCGGCAGCCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1193163-1194821	Sequence	ECIAI39_1121 fliF flagellar MS-ring protein (Protein is coded in complementary strand; from 1194821 to 1193163)