Sequence retrieval

Genome: Escherichia coli IAI39
Start position: 4396672
End position: 4396725
Length: 54

DNA sequence
>NC_011750, from 4396672 to 4396725 (54 bp); Escherichia coli IAI39 ATGAAGGAGAAGGTGGAGAAGGTGGAGAAGGTGGAGAAGGTGGAGAAGGTGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4396663-4396749	Sequence	ECIAI39_4225 - hypothetical protein (Protein is coded in complementary strand; from 4396749 to 4396663)