Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 1234716
End position: 1234742
Length: 27

DNA sequence
>NC_011773, from 1234716 to 1234742 (27 bp); Bacillus cereus AH820 CCAGTTGGTCCAGTTGGTCCAGTTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1234050-1234937	Sequence	BCAH820_1291 - BclA protein (Protein is coded in complementary strand; from 1234937 to 1234050)