Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 4095796
End position: 4095831
Length: 36

DNA sequence
>NC_011773, from 4095796 to 4095831 (36 bp); Bacillus cereus AH820 CAATATCAACAACAATATCAACAACAATACCAACAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4095714-4095869	Sequence	BCAH820_4308 - hypothetical protein (Protein is coded in complementary strand; from 4095869 to 4095714)