Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 432858
End position: 432902
Length: 45

DNA sequence
>NC_011773, from 432858 to 432902 (45 bp); Bacillus cereus AH820 TTGCCGCCAGAACCATTGCCACCAGAACCATTGCCGCCAGAACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 432381-433364	Sequence	BCAH820_0441 - lpxtg-motif cell wall anchor domain-containing protein (Protein is coded in complementary strand; from 433364 to 432381)