Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 4414329
End position: 4414382
Length: 54

DNA sequence
>NC_011773, from 4414329 to 4414382 (54 bp); Bacillus cereus AH820 CTCCGTCTGGTTGTTTATCTCCGTCTGGTTGTTTATCTCCGTCTGGTTGTTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4412591-4415314	Sequence	BCAH820_4661 - cell surface protein (Protein is coded in complementary strand; from 4415314 to 4412591)