Sequence retrieval

Genome: Buchnera aphidicola str. 5A (Acyrthosiphon pisum)
Start position: 285451
End position: 285474
Length: 24

DNA sequence
>NC_011833, from 285451 to 285474 (24 bp); Buchnera aphidicola str. 5A (Acyrthosiphon pisum) TTTTATTTTTTGATTTTTCTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 284670-285614	Sequence	BUAP5A_254 lepB signal peptidase I (Protein is coded in complementary strand; from 285614 to 284670)