Sequence retrieval

Genome: Buchnera aphidicola str. 5A (Acyrthosiphon pisum)
Start position: 337855
End position: 337878
Length: 24

DNA sequence
>NC_011833, from 337855 to 337878 (24 bp); Buchnera aphidicola str. 5A (Acyrthosiphon pisum) AATAATAAAAATAATAATAATAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 337313-338575	Sequence	BUAP5A_297 sucB 2-oxoglutarate dehydrogenase E2 component