Sequence retrieval

Genome: Buchnera aphidicola str. 5A (Acyrthosiphon pisum)
Start position: 353324
End position: 353347
Length: 24

DNA sequence
>NC_011833, from 353324 to 353347 (24 bp); Buchnera aphidicola str. 5A (Acyrthosiphon pisum) ATTATGAATATGATTATGATTATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 353319-354035	Sequence	BUAP5A_311 znuC high-affinity zinc uptake system ATP-binding protein ZnuC (Protein is coded in complementary strand; from 354035 to 353319)