Sequence retrieval

Genome: Buchnera aphidicola str. 5A (Acyrthosiphon pisum)
Start position: 62672
End position: 62695
Length: 24

DNA sequence
>NC_011833, from 62672 to 62695 (24 bp); Buchnera aphidicola str. 5A (Acyrthosiphon pisum) ATATAATTTTATAATTATAGAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 60941-62674	Sequence	BUAP5A_055 dnaG DNA primase (Protein is coded in complementary strand; from 62674 to 60941)