Sequence retrieval

Genome: Buchnera aphidicola str. 5A (Acyrthosiphon pisum)
Start position: 634449
End position: 634472
Length: 24

DNA sequence
>NC_011833, from 634449 to 634472 (24 bp); Buchnera aphidicola str. 5A (Acyrthosiphon pisum) TTTTATTGTTTTATTATTTTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 633079-634932	Sequence	BUAP5A_592 ilvD dihydroxy-acid dehydratase (Protein is coded in complementary strand; from 634932 to 633079)