Sequence retrieval

Genome: Buchnera aphidicola str. 5A (Acyrthosiphon pisum)
Start position: 172970
End position: 172994
Length: 25

DNA sequence
>NC_011833, from 172970 to 172994 (25 bp); Buchnera aphidicola str. 5A (Acyrthosiphon pisum) TTTTTTTTATTTTTCTTTTTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 172145-173113	Sequence	BUAP5A_158 nuoH NADH dehydrogenase subunit H