Sequence retrieval

Genome: Buchnera aphidicola str. 5A (Acyrthosiphon pisum)
Start position: 200915
End position: 200939
Length: 25

DNA sequence
>NC_011833, from 200915 to 200939 (25 bp); Buchnera aphidicola str. 5A (Acyrthosiphon pisum) TTTTTTTATTTTTTCTATTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 200583-201149	Sequence	BUAP5A_181 grpE heat shock protein GrpE2 (Protein is coded in complementary strand; from 201149 to 200583)