Sequence retrieval

Genome: Buchnera aphidicola str. 5A (Acyrthosiphon pisum)
Start position: 238102
End position: 238126
Length: 25

DNA sequence
>NC_011833, from 238102 to 238126 (25 bp); Buchnera aphidicola str. 5A (Acyrthosiphon pisum) TTTATTATATTTTTTTTTAGTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 237728-238792	Sequence	BUAP5A_212 murG undecaprenyldiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase (Protein is coded in complementary strand; from 238792 to 237728)