Sequence retrieval

Genome: Buchnera aphidicola str. 5A (Acyrthosiphon pisum)
Start position: 495390
End position: 495414
Length: 25

DNA sequence
>NC_011833, from 495390 to 495414 (25 bp); Buchnera aphidicola str. 5A (Acyrthosiphon pisum) ATAAAAAAAAATAAGATAATATAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 494559-495404	Sequence	BUAP5A_445 yggB mechanosensitive channel MscS