Sequence retrieval

Genome: Buchnera aphidicola str. 5A (Acyrthosiphon pisum)
Start position: 513412
End position: 513436
Length: 25

DNA sequence
>NC_011833, from 513412 to 513436 (25 bp); Buchnera aphidicola str. 5A (Acyrthosiphon pisum) TTTATTTTGTTTTAATATATTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 512819-513991	Sequence	BUAP5A_459 yajR hypothetical protein (Protein is coded in complementary strand; from 513991 to 512819)