Sequence retrieval

Genome: Buchnera aphidicola str. 5A (Acyrthosiphon pisum)
Start position: 411582
End position: 411608
Length: 27

DNA sequence
>NC_011833, from 411582 to 411608 (27 bp); Buchnera aphidicola str. 5A (Acyrthosiphon pisum) CGCTCGACCTGCTCGACCTGCTCGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 410809-412614	Sequence	BUAP5A_365 deaD ATP-dependent RNA helicase DeaD (Protein is coded in complementary strand; from 412614 to 410809)