Sequence retrieval

Genome: Buchnera aphidicola str. 5A (Acyrthosiphon pisum)
Start position: 442595
End position: 442621
Length: 27

DNA sequence
>NC_011833, from 442595 to 442621 (27 bp); Buchnera aphidicola str. 5A (Acyrthosiphon pisum) AAAAGAAAAACAAGAAAAAATAGAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 441550-444186	Sequence	BUAP5A_396 alaS alanyl-tRNA synthetase