Sequence retrieval

Genome: Buchnera aphidicola str. 5A (Acyrthosiphon pisum)
Start position: 121806
End position: 121835
Length: 30

DNA sequence
>NC_011833, from 121806 to 121835 (30 bp); Buchnera aphidicola str. 5A (Acyrthosiphon pisum) AAAAAAAATCATATAAAATCAAAAATAAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 121779-122273	Sequence	BUAP5A_115 rnfG nitrogen fixation protein