Sequence retrieval

Genome: Buchnera aphidicola str. 5A (Acyrthosiphon pisum)
Start position: 211422
End position: 211451
Length: 30

DNA sequence
>NC_011833, from 211422 to 211451 (30 bp); Buchnera aphidicola str. 5A (Acyrthosiphon pisum) TTTTTTTATAATTTTTTCTATTTCTTTATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 209260-211710	Sequence	BUAP5A_191 thrA bifunctional aspartokinase I/homoserine dehydrogenase I (Protein is coded in complementary strand; from 211710 to 209260)