Sequence retrieval

Genome: Buchnera aphidicola str. 5A (Acyrthosiphon pisum)
Start position: 232720
End position: 232749
Length: 30

DNA sequence
>NC_011833, from 232720 to 232749 (30 bp); Buchnera aphidicola str. 5A (Acyrthosiphon pisum) TTTTTTATTTCTTTTTTTATTATTTTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 232648-233802	Sequence	BUAP5A_209 ftsZ cell division protein FtsZ (Protein is coded in complementary strand; from 233802 to 232648)