Sequence retrieval

Genome: Buchnera aphidicola str. 5A (Acyrthosiphon pisum)
Start position: 41611
End position: 41640
Length: 30

DNA sequence
>NC_011833, from 41611 to 41640 (30 bp); Buchnera aphidicola str. 5A (Acyrthosiphon pisum) TTTTTCTATTTCTTTTTTTTTGTCTTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 40622-44650	Sequence	BUAP5A_033 rpoB DNA-directed RNA polymerase subunit beta (Protein is coded in complementary strand; from 44650 to 40622)