Sequence retrieval

Genome: Buchnera aphidicola str. 5A (Acyrthosiphon pisum)
Start position: 484017
End position: 484046
Length: 30

DNA sequence
>NC_011833, from 484017 to 484046 (30 bp); Buchnera aphidicola str. 5A (Acyrthosiphon pisum) AAATTTATTAAAATCAATTATAAATTATTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 483931-484266	Sequence	BUAP5A_435 ybeY hypothetical protein